GET THE APP

Bovine Genetic Variability and Therapeutic Response: Potential Application of Pharmacogenetics in Cattle
Veterinary Science & Technology

Veterinary Science & Technology

ISSN: 2157-7579

Open Access

Research Article - (2024) Volume 15, Issue 2

Bovine Genetic Variability and Therapeutic Response: Potential Application of Pharmacogenetics in Cattle

Jorge Luís de Figueiredo Salgado1*, Raquel Lima de Figueiredo Teixeira1, Márcia Quinhones Pires Lopes1, Michel José Sales Abdalla Helayel2, Harrison Magdinier Gomes1, Philip Noel Suffys1, Roberta Olmo Pinheiro3 and Adalberto Rezende Santos1
*Correspondence: Jorge Luís de Figueiredo Salgado, Laboratory of Molecular Biology Applied to Mycobacteria, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil, Tel: + 5521982345729, Email: ,
1Laboratory of Molecular Biology Applied to Mycobacteria, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil
2Department of Veterinary Collective Health, Fluminense Federal University, Niterói, Rio de Janeiro, Brazil
3Leprosy Laboratory, Oswaldo Cruz Institute, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil

Received: 14-Mar-2024, Manuscript No. jvst-24-129610; Editor assigned: 16-Mar-2024, Pre QC No. P-129610; Reviewed: 29-Mar-2024, QC No. Q-129610; Revised: 03-Apr-2024, Manuscript No. R-129610; Published: 10-Apr-2024 , DOI: 10.37421/2157-7579.2024.15.233
Citation: Salgado, Jorge Luís de Figueiredo, Raquel Lima de Figueiredo Teixeira, Márcia Quinhones Pires Lopes and Michel José Sales Abdalla Helayel, et al. “Bovine Genetic Variability and Therapeutic Response: Potential Application of Pharmacogenetics in Cattle.” J Vet Sci Technol 15 (2024): 233.
Copyright: © 2024 Salgado JLDF, et al. This is an open-access article distributed under the terms of the creative commons attribution license which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.

Abstract

Brazil has the world's largest commercial cattle herd. However, the production system faces challenges due to various diseases, which have led to an increased demand for effective prophylaxis and treatment, especially for conditions like bovine mastitis. Despite the predominant use of different medications in livestock farming, their effectiveness is often hampered by the variability of individual animal responses and genetic variations. Thus, we aimed to investigate the variability of the SLC15A2, SLC16A1 and SLC22A6 genes in cattle. In humans, these genes are linked to the metabolic pathways of commonly employed mastitis treatments by Cloxacillin (CLO) and Ampicillin (AMP). The study encompassed 50 Girolando breed cows from Fazenda Nossa Senhora de Fátima in the Municipality of Silva Jardim, Rio de Janeiro, Brazil. Genotyping was performed by direct PCR sequencing of DNA from whole blood and the investigated regions in the three genes covering all exons except exon 10 of the SLC22A6 gene. We identified 13 SNP including eight within SLC22A6 (c.248C>T, c.277G>T, c.292G>T, c.315T>C, c.50T>A, c.50C>T, c.37C>T and c.44C>T) and five within SLC16A1 (c.167G>A, c.242A>G, c.641C>T, c.644G>A and c.139C>T). Notably, no polymorphism was observed in SLC15A2. We here present a pilot that sheds some light on the potential of bovine pharmacogenetics and demonstrates a considerable variability in drug- metabolism associated genes in cattle.

Such studies pave the way for investigations of functionality of these SNPs and their potential associations with therapeutic responses in bovine mastitis treatment.

Keywords

Bovine • Mastitis • Genetic variability • Ampicillin • Cloxacillin • Pharmacogenetics

Introduction

Genetic variation is an important factor in drug response and can largely account for the observed interindividual variability in different treatments.

Single Nucleotide Polymorphisms (SNPs) are the most commonly observed genetic variations in DNA sequences and occur in at least 1% of the population They can occur in genes that encode drug target proteins or in enzymes involved in their metabolism and transport, potentially affecting pharmacokinetics (absorption, distribution, metabolism, and excretion) and pharmacodynamics (drug interaction with the target and the relationship between concentration and effect) [1].

Pharmacogenetics is a field that explores the intricate relationship between genetics and an individual's response to drugs by delving into how genetic variations impact an individual's reaction to medications, eventually improving drug therapies, minimizing adverse effects, and allowing treatment personalization. In animal pharmacogenetics, there is also investigation how genetic diversity can influence drug response, allowing veterinarians, researchers, and those involved in animal production to enhance the wellbeing of animals and optimize drug treatments in diverse scenarios.

Bovines are a conjuncture of species with significant economic importance that are utilized for various purposes, including meat and dairy production, understanding their pharmacogenetics carries substantial implications for veterinary medicine, livestock management and food safety.

Mastitis is an inflammatory and infectious disease of the mammary gland that can affect both humans and animals and when it manifests itself in its most aggressive form in cattle results in high losses for the entire dairy production chain [2-4]. The implementation of prevention and control measures for this disease in cattle is essential, but it is hampered by the variability of response to drug treatment, partly due to the genetic variability of cattle [5-7], partly due to variability of the ethiologic agent and partly due to the subjectivity in the antibiotic agent usage. The choice of drug is not guided by microbiological tests for isolation, identification of the etiologic agent and drug susceptibility testing. Consequently, despite the variety of drugs available on the market for treating this infection, both at subclinical and symptomatic levels, efficacy varies significantly.

Several studies have investigated the presence of genetic variants in genes specifically related to drug metabolism [8-10], drug transport [11,12] and pharmacokinetics in cattle [13]. However, none have been investigated for the presence of polymorphisms in drug transporter genes with therapeutic response. Although several antibiotics are used in the treatment of bovine mastitis the choice of a specific antibiotic depends on several factors, such as the agent causing the infection, bacterial sensitivity, and the severity of the disease. Even so, the effectiveness of the most common used drugs, Ampicillin (AMP) and Cloxacillin (CLO), used for the treatment of mastitis caused by Staphylococcus aureus, varies considerably. Contrary to human mastitis, the influence of genetic factors on this variation is still unknown for bovines.

In humans, AMP/CLO are transported via peptides of the SLC (Solute Carrier) family, primarily involving the genes SLC15A2 [14,15], SLC16A1 [16], SLC22A6 [17] and ABC [18,19]. Given the lack of literature data pertaining to these genes in cattle, we have drawn upon the available human data and employed bioinformatics tools to pinpoint their orthologs within the bovine context. The primary objective of this study was to evaluate the genetic variability of these genes in the Girolando breed. We explore this through a SNP discovery through direct PCR sequencing of the gene coding sequences.

Materials and Methods

Study population and sample collection

In an observational descriptive study model the variability of the drug transporter genes SLC15A2, SLC16A1 and SLC22A6 in cattle was evaluated. Blood samples were collected from a total of 50 Girolando cows at the Nossa Senhora de Fátima dairy farm, located in the municipality of Silva Jardim, Rio de Janeiro, Brazil. The entire process of sample selection and collection was directly coordinated by veterinary professionals at the farm. The study animals, ranging from 36 to 72 months of age, were categorized as adult cows. Employing a vacutainer system (BD Vacutainer®) containing sodium citrate as an anticoagulant, 3mL of blood was drawn from each animal's coccygeal complex. The collected samples were homogenized through inversion and subsequently stored at a temperature of -20ºC.

DNA extraction

DNA was extracted from 200 μL of blood using the commercial kit "QIAamp DNA Blood®" (QIAGEN), following the manufacturer's instructions. The quality and quantity of the extracted DNA were assessed using the Qubit 3.0 model (Invitrogen™ Qubit™ 3 Fluorometer).

Strategies for PCR amplification of target sequences

After the identification of the SLC22A6, SLC15A2 e SLC16A1 genes in the bovine genome (https://www.ncbi.nlm.nih.gov/gene), a set of primers were designed for the amplification and sequencing of nine exons of the SLC22A6 gene (NCBI Reference Sequence: NC_037356.1), four exons of the SLC16A1 gene (NCBI Reference Sequence: AC_000160.1) and three exons of the SLC15A2 gene (NCBI Reference Sequence: AC_000158.1). Primers were designed using primer3plus software (http://www.bioinformatics.nl/cgi bin/ primer3plus/primer3plus.cgi) based in the reference sequences obtained.

PCR amplification and sequencing of the different targets

Samples were amplified by conventional PCR using an exon-specific set of primers (Table 1). For amplification of the different exons of SLC22A6, SLC15A2 e SLC16A1 genes, the PCR and cycling conditions were determined as follows: a total amount of 20 ng of genomic DNA was added to a reaction mixture with a final volume of 50 μL, containing 2 mM MgCl2, 200 μM dNTPs, 1X PCR buffer, 1U of taq DNA polymerase (Invitrogen™), and 20 μM of each primer. Samples were incubated at 94 ℃ for 5 min, followed by 35 cycles of 94°C for 1 min.; 59 ℃, for 1 min. and 72 ℃ for 90 sec. The final extension took place at 72 ℃ for 5 minutes. Especially for the exon 3 of SLC16A1, because of the size of the amplified product (1000 bp) to be sequenced, two internal oligonucleotides were used generating two overlapping fragments.

Table 1: Primer descriptions for PCR-amplification and sequencing of 10 exons from the SLC22A6 gene, 5 exons from the SLC16A1 gene and 3 exons from the SLC15A2 gene.

Gene Exon Product Size (bp) Left Primer Right Primer
SLC22A6 1 674 TTCAGTTCCAGGAGCGACTT TTTCTTGACCCTGCAACTCC
SLC22A6 2 413 GGAGTTGCAGGGTCAAGAAA GCCTGGGACCGTGATGTAT
SLC22A6 3 436 CTAACTGGGGCTGGACTGAG AGGACGAAGGCTGTATGCTG
SLC22A6 4 595 GCAAAAACACACAGCAAGGA AGGAGGCTGGAGAATTGGAT
SLC22A6 5 497 AACCAAGACCCCATGTTGAG TGTGGTCAGCTCCTTCTTCA
SLC22A6 6 429 TCAATGGGAAGCAGGAAGAG ATGCCTTTCACAGCTGGTCT
SLC22A6 7 500 TGCATGTTAAATGTCAGAAGAAA AGCAAGAGAGGTTCGGACAA
SLC22A6 8 298 ACCCATGAGCACCTTGGTC CCCTTTGACATGTGCCCTA
SLC22A6 9 297 CAGACGGGCTTGGGAATG GGGAAGAGGAGGCCTAGGTT
SLC22A6 10 679 GGGGTCCTTGTCCCTGTGT CGTGTGCAGGAACTGGAAT
SLC16A1 1 598 GGGAAAAACTTACAAAGCCTGT CAAAGCAAGAGTTGTCATTGTTA
SLC16A1 2 361 CATTGCCTTTGTGTGTCTGC TGCTTGTCAAAATGATAATCAGC
SLC16A1 3 1000 TGGTTAAGTAATGCAAAATATGTCTC TCCCAATCTTCTCTGCCTGT
SLC16A1 3 230 (INTERNAL) GCAAATACAGATCTCATTGG AGCCTTCTCACTAGAGTAAT
SLC16A1 4 600 ACCCCAAATCAGTGTGACAT GGCTACTGGTAAGGAGTGAAACA
SLC15A2 1 399 CCCATGTATTGTTAGTTAACCAGTG TTTAGATCTGGTTTATAGGTTCATTCT
SLC15A2 2 374 AGGGACCATTGCTTCTTCAC AAATCCCACCAGGCATTTTT
SLC15A2 3 500 CCTTTCACCCTCACAACTCC TGGAAAAACTGATAATGAAGAGATAAA

Evaluation of the PCR product was achieved by electrophoresis on a 1% agarose gel followed by ethidium bromide (0,5μg/mL) staining. The PCR products were purified with ChargeSwitch® PCR Clean-UP Kit (Invitrogen, USA), according to the manufacturer’s recommendations and subsequently used for direct Sanger sequencing. The sequencing reaction was performed using the aforementioned primers and the ABI PRISM Big Dye Terminator Kit v. 3.1 Kit (PE Applied BioSystems) according to the manufacturer's recommendations on an ABI PRISM 3730 DNA Analyzer (PE Applied BioSystems).

Sequence analysis and statistics

Sequence data from each sample underwent analysis to identify SNPs by alignment against the reference sequences of the genes: SLC22A6, SLC15A2 and SLC16A1 using SeqScape v.2.6 software from Applied BioSystems.

To determine the frequencies of polymorphisms and genotypes and to assess deviations from the Hardy- Weinberg equilibrium, we employed the Hardy-Weinberg exact balance test [20] with the assistance of SNPassoc v.2.0.Haplotype reconstruction was carried out using the Bayesian method, which is implemented in PHASE v.2.1.1. This method was used to ascertain the most likely haplotype pairs, ensuring unambiguous genotyping and determination of the most likely allele pairs [21,22].

Results

Animals

A total of 50 vaccinated, adult Girolando breed cows, which were registered, were included in the study. All the animals were adults, not in the lactation period, and were free from mastitis.

Genotyping

DNA samples isolated from blood of each animal underwent PCR amplification and genotyping through sequencing. Upon analyzing the resulting sequences, eight SNPs were identified in the SLC22A6 gene, distributed across the exons as follows: four SNPs within exon 1 (c.248C>T, c.277G>T, c.292G>T, c.315T>C), one SNP within exon 3 (c.50T>A), one SNP within exon 4 (c.50C>T), one SNP within exon 5 (c.37C>T), and one SNP within exon 8 (c.44C>T). Genotype and allele frequencies are presented in Table 2. The minor allele frequencies ranged from 0.02 (less common) for SNPs c.277G>T, c.292G>T, and c.44C>T to 0.22 (most common) for SNPs c.248C>T and c.315T>C.

Table 2: Genotype and Minor Allele Frequencies (MAF) of the SNPs identified in the SLC22A6 gene.

SLC22A6
SNP Genotypes N= 50 Minor Allele MAF (%)
c.248C>T CC 2958% T 0.22
CT 2040%
TT 12%
c.277G>T GG 4896% T 0.02
GT 24%
TT 0
c.292G>T GG 4896% T 0.02
GT 24%
TT 0
c.315T>C TT 2958% C 0.22
TC 2040%
CC 12%
c.50T>A TT 4794% A 0.03
TA 36%
AA 0
c.50C>T CC 3570% T 0.16
CT 1428%
TT 12%
c.37C>T CC 4590% T 0.05
CT 510%
TT 0
c.44C>T CC 4896% T 0.02
CT 24%
TT 0

For the SLC16A1 gene, five SNPs were identified, with one SNP located in exon 1 (c.167G>A) and four SNPs situated in exon 3 (c.139C>T, c.242A>G, c.641C>T and c.644G>A). Minor allele frequencies ranged from 0.01 (less common) for SNPs c.139C>T and c.167G>A, to 0.59 (higher than the normal allele) for SNP c.242A>G (Table 3). No polymorphism was identified in the SLC15A2 gene.

Table 3: Genotype and Minor Allele Frequencies of the SNPs identified in the SLC16A1 gene.

SNP Genotypes N=50 MA MAF (%)
c.167G>A GG 4998% A 0.01
GA 12%
AA 0
c.242A>G AA 1530% G 0.59
AG 1122%
GG 2448%
c.641C>T CC 4896% T 0.02
CT 24%
TT 0
c.644G>A GG 3468% A 0.19
GA 1326%
AA 36%
c.139C>T CC 4998% T 0.01
CT 12%
TT 0

Haplotypes frequencies

Haplotype identification in the SLC22A6 and SLC16A1 genes was accomplished using PHASE v2.1.1 software. Seven distinct haplotypes were identified for SLC22A6, and seven for SLC16A1. Tables 4 and 5 displays these haplotypes and their individual frequencies ranging from 0.01 to 0.55 for SLC22A6 and from 0.01 to 0.40 for SLC16A1 respectively.

Table 4: Haplotype frequencies Identified in SLC22A6 gene.

  SLC22A6   Haplotypes N Frequency
    Exon 1 Exon 3 Exon 4 Exon 5 Exon 8    
N Alleles c.248C>T c.277G>T c.292G>T c.315T>C c.50T>A c.50C>T c.37C>T c.44C>T    
1 CGGTTCCC                 55 0.55
2 CGGTTCTC             X   5 0.05
3 CGGTTTCC           X     15 0.15
4 CGGTACCC         X       1 0.01
5 CTTTACCT   X X   X     X 2 0.02
6 TGGCTCCC X     X         21 0.21
7 TGGCTTCC X     X   X     1 0.01
                  Total 100 1

Table 5: Haplotype frequencies identified in SLC16A1 gene.

SLC16A1  Haplotypes
    Exon 1 Exon3    
  Alleles c.167G>A c.139C>T c.242A>G c.641C>T c.644G>A N Frequency
1 GCGCG     X     38 0.38
2 GCGCA     X   X 17 0.17
3 GCGTG     X X   2 0.02
4 GCACG           40 0.4
5 GCACA         X 1 0.01
6 GTGCA   X X   X 1 0.01
7 ACGCG X   X     1 0.01
            Total 100 1

Excluding the wild-type haplotypes for both genes, the most common haplotypes were number6 (TGGCTCCC) for SLC22A6 and the number 1 (GCGCG) for SLC16A1.

Discussion

With the sequencing of the bovine genome and the development of nextgeneration sequencing techniques, knowledge about bovine genetic variability in the world has grown significantly, making it possible to conduct studies for a better understanding of this diversity in different breeds [23,24].

Currently, six different SNP chips are available for cattle genotyping, offering a range of low to high density options across two distinct platforms. Five of these SNP chips are provided by Illumina (San Diego, CA), including the Golden Gate Bovine3K BeadChip (Bovine3k), Infinium BovineLD BeadChip (BovineLD), Infinium BovineSNP50 v.1 BeadChip (BovineSNP50v.1), Infinium BovineSNP50 v.2 BeadChip (Bov ineSNP50v.2), and Infinium BovineHD BeadChip (BovineHD). Additionally, Affymetrix has also an Array, the Axiom GenomeWide BOS 1 Bovine Array, which includes 648, 875 SNP probes (Axiom Bos1) [25].

Exploring the functional relevance of DNA variants in livestock genomics including bovine populations [26], although not always exclusively focused on pharmacogenes offers insights into SNP analysis and the implications of genetic variants in livestock breeding and production [27].

In this context, studies examining the association of genetic markers in genes involved in pharmacokinetics,and consequently, their influence on therapeutic responses to different drugs, hold significant importance in herd management. Such research aims to propose and implement more effective therapies to reduce losses and enhance the productive quality of cattle. It is important to note, however, that research in bovine pharmacogenetics is still in its early stages, with much remaining to be explored to gain a comprehensive understanding in the field and its relationship to drug responses in cattle.

Common drug transporter gene families that play a significant role in drugcarrier function include the ATP-Binding Cassette (ABC) transporters and the Solute Carrier (SLC) superfamily of transporters. These genefamilies have been extensively studied in various species, including bovines, for their role in drug transport and it is widely recognized that significant genetic variation exists in nearly every drug transporter. This genetic variation can lead to various outcomes, affecting aspects such as the expression, stability, folding, localization, and degradation of the transporter protein. Furthermore, they can influence the transport characteristics, substrate affinity, binding, and transport kinetics of the transporter [27].

The economic impact of pathological disorders, such as mastitis, is of crucial concern for the dairy sector. The recommended treatment, similar to human mastitis, yields variable outcomes. To address the lack of available data concerning the variability of pharmacogenes, and in particular transporter genes, this study focused on a partial mapping of the coding regions of bovine orthologs corresponding to human genes SLC15A2, SLC16A1 and SLC22A6, which are involved in the transport of ampicillin and cloxacillin in Girolando cattle. The Girolando breed is the result of crossbreeding Holstein cattle with the Gir breed is prevalent in most Brazilian dairy farms and has undergone genetic improvement, with the objective of sustainable milk production in tropical and subtropical regions [28]. We detected SNPs in SLC16A1 and SLC22A6), SLC22A6 being the most polymorphic and SLC15A2 being 100% conserved.

Using the Bovine Genome Variation Database (BGVD), which is a useful tool for in-depth analysis in bovine biology and livestock by integrating data from other databases such as NCBI, UCSC Genome Browser, AnimalQTLdb, AmiGO 2 and KEGG, we found that in the SLC22A6 gene, 35 SNPs have been described in the coding region, among which 4 SNPs out of the 13 described by us (Table 6). In the SLC16A1 genes, 22 SNPs have been described, and in the SLC15A2 gene, 2 SNPs, all in the coding region.

Table 6: Description of the four SNPs already described and identified within SLC22A6 coding region.

Coding Region Protein Region Genomic Region Alleles MA MAF Consequence Type Variant ID
c.248C>T  p.Ser83Phe g. 42271244 G/A A 0.081 missense_variant rs524446512
c.277G>T p.Gly93Cys g.42271215 C/A A 0.043 missense_variant rs381152264
c.292G>T p.Gly98Cys g.42271200 C/A A 0.046 missense_variant rs378269413
c.315T>C p.Cys105Cys g.42271177 A/G G 0.086 synonymous_variant rs437302202

This database contains information about 60,439,391 SNPs (single nucleotide polymorphisms), 6,859,056 indels (insertions/deletions), and 76,634 CNV regions (copy number variations) derived from 432 animals. It uses 54 cattle breeds in 6 groups of ancestral cattle, excluding the Girolando hybrid [29].

The frequencies of the minor alleles among the eight SNPs within the SLC22A6 gene ranged from 1% to 22%, with the highest frequency observed for SNPs c.248C>T and c.315T>C, both considered to have a very high frequency. In the case of the SLC16A1 gene, the variation in minor allele frequencies ranged from 1% to 59%, with the SNP c.242A>G showing a higher frequency compared to the normal allele.

The analysis of the distribution of these 4 SNPs of the SLC22A6 gene among the 54 breeds of cattle in the BGVD database showed the absence of the SNPs c.315T>C, c.292G>T, and c.277G>T in Gir and Holstein breeds. In the Gir breed, the MAF of the c.292G>T and c.277G>T SNPs was low, however, surprisingly, for the SNP c.315T>C, the frequency was 22%.

Although there are several possibilities to explain the emergence and increase in frequency of a specific SNP in a hybrid cattle population. The exact explanation would depend on additional informations, such as the reproductive history of the hybrid population, detailed genetic data from ancestral populations and the selective management practiced, among other factors. However, we most likely consider a Founder Effect as the greatest probability to explain this significant increase in frequency in the hybrid population since the frequency data for the c.315T>C SNP were based on the genotyping of only 45 animals of the Holstein breed and 3 of the Gir breed, and may not have been detected due to sampling limitations.

In relation to the SNP c.248C>T, the MAF was 15 times higher among Gir in comparison to c.248C>T in Holstein and 22% Girolando, however, the same effect can be attributed due to the small sample size of the Gir breed.

Domestic cattle (Bos taurus) are divided into two subspecies: Bos taurus taurus (taurine cattle of European origin) and Bos taurus indicus (zebu cattle of Asian origin). Crossbreeding between individuals of both subspecies is common, occurring in herd genetic improvement programs and on properties where breeding is natural and uncontrolled. These hybrids, such as the Girolando breed (resulting from crossbreeding Holstein (5/8) and Gir (3/8), which we used in our study, are widely employed to combine the productivity of taurine cattle with the ruggedness and adaptability to tropical environments seen in zebu cattle [30].

Analyzing SNPs with high frequencies can be valuable for undestanding the genetic history and adaptation of populations. It can also help in identifying variants associated with specific traits. For instance, a high SNP frequency would be, among others, the result of a Positive Selection, if the SNP is linked to a trait or characteristic that provides a significant advantage [31,32] of a Genetic Drift, in small or isolated populations in which the frequency of an SNP may fluctuate randomly from generation to generationdue to genetic drift. In some circumstances, this drift can increase the frequency of an SNP to a high level [33] and Environment-Dependent Selection Pressure, in dynamic or changing environments, various alleles may be favored at different times. Frequent environmental shifts can result in the selection of different alleles at different times, ultimately leading to the prevalence of multiple alleles at high frequencies [34]. Further studies, including larger sample sizes and representatives of pure breeds (Holstein and Gir), should be conducted to provide a more comprehensive and well-founded explanation.

Conclusion

Seven distinct haplotypes were identified for SLC22A6 and SLC16A1 genes, with frequencies ranging from 1% to 40% for SLC16A1 and from 1% to 55% for SLC22A6. Among the potential factors that could account for these high frequencies, we emphasize the role of Linkage Disequilibrium (LD). These SNPs may be in strong LD with each other, indicating that they tend to be inherited together. Even if each individual SNP has a lower frequency, the combined haplotype can have a higher frequency if it is frequently inherited as a unit (35), and Functional Diversity. The presence of multiple haplotypes with relatively high frequencies may suggest functional diversity in the gene. Each haplotype might have distinct effects on drug transport, possibly in response to different drugs or physiological conditions, making them advantageous in different contexts. To understand the exact mechanisms and functional significance of these haplotypes, further genetic and functional studies, such as association studies, functional assays, and evolutionary analyses, will be necessary. These studies can help uncover the specific roles of these haplotypes in drug transport and their implications for cattle treatment and drug responses.

Author Contributions

JLFS - Performed the experiments and wrote the manuscript.

RLFT - Performed the sequence analysis and manuscript revision.

MQPL - Performed sequencing experiments and manuscript revision.

MJSAH - Performed the animal selection and sample collection.

HMG - Did the manuscript revision.

PNS and ROP - Provided laboratorial support.

ARS - Conceptualized the study, proofread the manuscript

Funding

This work was supported by Oswaldo Cruz Institute's Budget and Targets program, Fiocruz.

Data Availability Statement

The experimental protocol was approved by the Ethics Committee on the Use of Animals ECUA/IOC – Oswaldo Cruz Foundation number (L-016/2021).

Acknowledgment

The authors thank the livestock farmer, Mr. Josélio (Fazenda Nossa Senhora de Fátima), for the collaboration and supply of biological material.

Conflict of Interest

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

References

  1. Damas, Joana, Marco Corbo and Harris A. Lewin. "Vertebrate chromosome evolution." Annu Rev Anim Biosci 9 (2021): 1-27.

    Google Scholar, Crossref, Indexed at

  2. Silva, A. W. B., R. P. Ribeiro, V. G. Menezes and R. S. Barberino, et al. "Expression of TNF-α system members in bovine ovarian follicles and the effects of TNF-α or dexamethasone on preantral follicle survival, development and ultrastructure in vitro." Anim Reprod Sci 182 (2017): 56-68.

    Google Scholar, Crossref, Indexed at

  3. Gabli, Zahra, Zouhir Djerrou and Mounira Bensalem. "Prevalence of mastitis in dairy goat farms in Eastern Algeria." Vet World 12 (2019): 1563.

    Google Scholar, Crossref, Indexed at

  4. Fursova, Ksenia, Anatoly Sorokin, Sergey Sokolov and Timur Dzhelyadin, et al. "Virulence factors and phylogeny of Staphylococcus aureus associated with bovine mastitis in Russia based on genome sequences." Front Vet Sci 7 (2020): 135.

    Google Scholar, Crossref, Indexed at

  5. Van Tassell, Curtis P., Timothy PL Smith, Lakshmi K. Matukumalli and Jeremy F. Taylor, et al. "SNP discovery and allele frequency estimation by deep sequencing of reduced representation libraries." Nat Methods 5 (2008): 247-252.

    Google Scholar, Crossref, Indexed at

  6. https://www.ncbi.nlm.nih.gov/snp/%20accessed%20on%20November%2010,%202021
  7. https://www.animalgenome.org/Q%20TLdb/cattle.html%20accessed%20on%20December%208,%202021
  8. Giantin, Mery, Minna Rahnasto-Rilla, Roberta Tolosi and Lorena Lucatello, et al. "Functional impact of cytochrome P450 3A (CYP3A) missense variants in cattle." Sci Rep 9 (2019): 19672.

    Google Scholar, Crossref, Indexed at

  9. Carvalho Henriques, Beatriz, Esther H. Yang, Diego Lapetina and Michael S. Carr, et al. "How can drug metabolism and transporter genetics inform psychotropic prescribing?." Front Genet 11 (2020): 491895.

    Google Scholar, Crossref, Indexed at

  10. Forsberg, Erica M., Tao Huan, Duane Rinehart and H. Paul Benton, et al. "Data processing, multi-omic pathway mapping, and metabolite activity analysis using XCMS Online." Nat Protoc 13 (2018): 633-651.

    Google Scholar, Crossref, Indexed at

  11. Floerl, Saskia, Annett Kuehne and Yohannes Hagos. "Functional and pharmacological comparison of human, mouse, and rat organic cation transporter 1 toward drug and pesticide interaction." Int J Mol Sci 21 (2020): 6871.

    Google Scholar, Crossref, Indexed at

  12. Drew, David, Rachel A. North, Kumar Nagarathinam and Mikio Tanabe. "Structures and general transport mechanisms by the Major Facilitator Superfamily (MFS)." Chem Rev 121 (2021): 5289-5335.

    Google Scholar, Crossref, Indexed at

  13. Wang, Minghui, Xiangzhe Zhang, Hongbo Zhao and Qishan Wang, et al. "Comparative analysis of vertebrate PEPT1 and PEPT2 genes." Genetica 138 (2010): 587-599.

    Google Scholar, Crossref, Indexed at

  14. Dai, Tongcheng, Na Li, Lingzhi Zhang and Yuanxing Zhang, et al. "A new target ligand ser–glu for PePT1-overexpressing cancer imaging." Int J Nanomedicine (2016): 203-212.

    Google Scholar, Crossref, Indexed at

  15. Viennois, Emilie, Adani Pujada, Jane Zen and Didier Merlin. "Function, regulation, and pathophysiological relevance of the POT superfamily, specifically PepT1 in inflammatory bowel disease." Compr Physiol 8 (2018): 731.

    Google Scholar, Crossref, Indexed at

  16. Liu, Zhe, Yiming Sun, Haiyu Hong and Surong Zhao, et al. "3-bromopyruvate enhanced daunorubicin-induced cytotoxicity involved in monocarboxylate transporter 1 in breast cancer cells." Am J Cancer Res 5 (2015): 2673.

    Google Scholar, Indexed at

  17. Sekine, Takashi, Hiroki Miyazaki and Hitoshi Endou. "Molecular physiology of renal organic anion transporters." Am J Physiol Renal Physiol 290 (2006): F251-F261.

    Google Scholar, Crossref, Indexed at

  18. Zhang, Kai Xi, Chi Kio Ip, Sookja Kim Chung and Kei Kei Lei, et al. "Drug-resistance in rheumatoid arthritis: The role of p53 gene mutations, ABC family transporters and personal factors." Curr Opin Pharmacol 54 (2020): 59-71.

    Google Scholar, Crossref, Indexed at

  19. Kovacsics, Daniella, Izabel Patik and Csilla Özvegy-Laczka. "The role of organic anion transporting polypeptides in drug absorption, distribution, excretion and drug-drug interactions." Expert Opin Drug Metab Toxicol 13 (2017): 409-424.

    Google Scholar, Crossref, Indexed at

  20. Wigginton, Janis E., David J. Cutler and Gonçalo R. Abecasis. "A note on exact tests of Hardy-Weinberg equilibrium." Am J Hum Genet 76 (2005): 887-893.

    Google Scholar, Crossref, Indexed at

  21. Stephens, Matthew and Peter Donnelly. "A comparison of bayesian methods for haplotype reconstruction from population genotype data." Am J Hum Genet 73 (2003): 1162-1169.

    Google Scholar, Crossref, Indexed at

  22. Stephens M, Scheet P. “Accounting for decay of linkage disequilibrium in haplotype inference and missing-data imputation.” Am J Hum Genet 76 (2005): 449-462.

    Google Scholar, Crossref, Indexed at

  23. Daetwyler, Hans D., Aurélien Capitan, Hubert Pausch and Paul Stothard, et al. "Whole-genome sequencing of 234 bulls facilitates mapping of monogenic and complex traits in cattle." Nat Genet 46 (2014): 858-865.

    Google Scholar, Crossref, Indexed at

  24. Nicolazzi, Ezequiel Luis, Matteo Picciolini, Francesco Strozzi and Robert David Schnabel, et al. "SNPchiMp: A database to disentangle the SNPchip jungle in bovine livestock." BMC Genom 15 (2014): 1-6.

    Google Scholar, Crossref, Indexed at

  25. Riggio, Valentina, Abdulfatai Tijjani, Rebecca Callaby and Andrea Talenti, et al. "Assessment of genotyping array performance for genome-wide association studies and imputation in African cattle." Genet Sel Evol 54 (2022): 58.

    Google Scholar, Crossref, Indexed at

  26. Masharing, Nampher, Monika Sodhi, Divya Chanda and Inderpal Singh, et al. "ddRAD sequencing based genotyping of six indigenous dairy cattle breeds of India to infer existing genetic diversity and population structure." Sci Rep 13 (2023): 9379.

    Google Scholar, Crossref, Indexed at

  27. Sissung, Tristan M., Sarah M. Troutman, Tessa J. Campbell and Heather M. Pressler, et al. "Transporter polymorphisms affect normal physiology, diseases, and pharmacotherapy." Discov Med 13 (2012): 19.

    Google Scholar, Indexed at

  28. Parré, José Luiz, Sandra Mara Schiavi Bánkuti and Nelito Antonio Zanmaria. "Perfil socioeconômico de produtores de leite da região Sudoeste do Paraná: um estudo a partir de diferentes níveis de produtividade." Revista de Economia e Agronegócio 9 (2011).

    Google Scholar

  29. da Costa, Nathalia Silva, Marcos Vinicius GB da Silva, João Cláudio do Carmo Panetto and Marco Antonio Machado, et al. "Spatial dynamics of the Girolando breed in Brazil: Analysis of genetic integration and environmental factors." Trop Anim Health Prod 52 (2020): 3869-3883.

    Google Scholar, Crossref, Indexed at

  30. Nielsen, Rasmus. "Molecular signatures of natural selection." Annu Rev Genet 39 (2005): 197-218.

    Google Scholar, Crossref, Indexed at

  31. Pritchard, Jonathan K. and Anna Di Rienzo. "Adaptation–not by sweeps alone." Nat Rev Genet 11 (2010): 665-667.

    Google Scholar, Crossref, Indexed at

  32. Gillespie, John H. Population genetics: A concise guide. JHU Press (2004).

    Google Scholar

  33. Thompson, John N. "Rapid evolution as an ecological process." Trends Ecol Evol 13 (1998): 329-332.

    Google Scholar, Crossref

  34. Schwab, Manfred, ed. Encyclopedia of cancer. Springer Science & Business Media (2008).

    Google Scholar

Google Scholar citation report
Citations: 4472

Veterinary Science & Technology received 4472 citations as per Google Scholar report

Veterinary Science & Technology peer review process verified at publons

Indexed In

arrow_upward arrow_upward