GET THE APP

The Investigation of the Relation of rs7816345, rs17001868 and rs3788577 Polymorphisms with Breast Cancer in the Population of East Azerbaijan
Molecular and Genetic Medicine

Molecular and Genetic Medicine

ISSN: 1747-0862

Open Access

Research Article - (2021) Volume 15, Issue 4

The Investigation of the Relation of rs7816345, rs17001868 and rs3788577 Polymorphisms with Breast Cancer in the Population of East Azerbaijan

Pour PM*
*Correspondence: Pour PM, Department of Oncology, Institute of Medical Sciences, Semnan University of Medical Sciences, Iran, Email:
Department of Oncology, Institute of Medical Sciences, Semnan University of Medical Sciences, Iran

Received: 10-Mar-2020 Published: 31-May-2021 , DOI: 10.37421/1747-0862.2021.15.491
Citation: Pour Parisa Malek. “The Investigation of the Relation of rs7816345, rs17001868 and rs3788577 Polymorphisms with Breast Cancer in the Population of East Azerbaijan.” J Mol Genet Med 15 (2021): 491.
Copyright: © 2021 Pour PM. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Abstract

Introduction: Breast cancer is one of the most common types of cancer among women and is the first cause of cancer deaths in women. According to world health statistics, one out of every 8 to 10 women develops breast cancer. According to Iran statistics, out of every 10 to 15 women in our country, one woman has probably breast cancer, so the aim of this study was to investigate the relation between ADSL gene rs3788577 polymorphism, rs7816345 polymorphism (near znf703 gene) and rs17001868 polymorphism associated with SGSM3 gene with breast cancer in the population of East Azerbaijan.

Methods: In this study, 100 samples from patients with breast cancer and 100 blood samples from healthy individuals were selected as control group. Then, according to the protocol, DNA was extracted from all samples with the DNA extraction kit. Electrophoresis was then carried out to assure the quality of the extracted DNA, and quantified by spectrophotometer. The samples were then PCR-amplified with specific primers and finally "PCR products were treated with the restriction enzyme and electrophoresed on agarose gel". Data were analyzed by SPSS software version 10 using descriptive and chi-square tests and significance level less than 0.05 was considered.

Results: The results of ADSL gene rs3788577 polymorphism analysis showed that the percentage of G allele was 14.5% and 18.1% in healthy and diseased individuals, respectively. Examination of these data shows that the G-allele has a 44% increase in diseased people compared to healthy people. The results of SGSM3 gene polymorphism 17001868 showed that the percentage of T-allele was 15% and 21.5%, respectively. The examination of these results showed that T-allele increased 6.5% in healthy individuals and also rs7816345 polymorphism results showed that the percentage of T-allele in healthy subjects was reported to be 44.5% and 69.5%. Examination of these data shows that the T-allele has an 11% increase in diseased people compared to healthy people.

Discussion: Polymorphism analysis of rs378857 rs7816345 showed that there is probably a relationship between increased G allele (44%) and increased T allele (25%) respectively and the incidence of breast cancer and its prevalence in Azerbaijan population. On the other hand, rs 17001868 polymorphism analysis showed that there is "probably no relation between the T allele increase (by 6.5%) and the incidence of breast cancer.

Conclusion: Given that current methods of treatment for all types of cancers have serious consequences, discovering new ways to diagnose the disease early by identifying specific biomarkers for that type of cancer is essential and can open new therapeutic horizons.

Keywords

Breast cancer • Polymorphism • rs3788577 • rs7816345 • rs17001868

Introduction

Cancer is a dynamic process that causes cellular molecular alterations, interfering with its proliferation system by numerous unknown and independent variables. Cancer is responsible for more than 20% of all deaths [1]. Breast cancer, with a 25.5% share among cancers, is the first major cause of cancer deaths and deaths among women worldwide and in Iran as well. So that every three minutes, one woman in the United States gets breast cancer. Over 502,000 women die each year from this type of cancer. Global studies have shown that the number of patients with breast cancer is increasing. West Asia is one of the areas with the highest incidence of cancer. Since Iran is located in this region, the incidence of breast cancer has increased in Iran [2].

The Asian National Census Bureau reported that the prevalence of breast cancer in Iran was 21.4% [3]. Newly available methods can only help 60% of breast cancer patients with diagnosis and treatment. If breast cancer is diagnosed at an early stage, more than 90% of patients will be treated and it will reduce their mortality. Early detection of breast cancer is a screening procedure and one of the most important methods of breast cancer screening can be self-examination by a physician. Mammography noted.

Your head swells out of the money supply at the top of your head, with a higher growth rate, higher in the lungs or in the lungs [4]. Tumorigenesis is a complex cancer that is affected by many factors including age, geographic diversity, lifestyle and genetic factors [5]. Available evidence suggests that breast cancer is the result of an interaction between genetic elements and possible environmental factors. Ethnicity also plays an important role in the risk of breast cancer with the lowest incidence in certain groups of Asian women to the highest incidence in Caucasian women.

Polymorphisms are genetic variants whose rare alleles occur in a population with a frequency of at least 1%, regardless of their functional or pathogenetic significance [6,7]. Polymorphisms, or SNPs, are also referred to as individual genetic differences that are associated with the susceptibility to certain diseases.

Research shows that mutations and polymorphisms of genes associated with breast cancer play an important role in the prognosis and prediction of tumor formation, so that the diversity of the ESR1 allele is associated with the risk of breast cancer in whites, with specific clinical features including family history of breast cancer and lymph node metastasis are related, although this effect has sometimes been reported as positive or sometimes negative. At present, little is known about the expression of the ESR1 gene, the rate of mutation, and its allelic diversity in breast cancer among Azerbaijanis, especially those residing in Iran. Rs3788577 ADSL Gene-Related Polymorphism one of the polymorphisms associated with breast cancer. The ADSL gene is present in the 22q13.1-13.2 gene locus. This gene lasted 6 kb in humans and was fully sequenced by Kmoch in year 6. The coding sequence of this gene consists of 5 bp, which encodes a 5-amino acid protein. Molecular analysis studies of the affected families revealed four distinct mutations in these families. According to the latest update to the human gene mutation database, about 3 point mutations have been identified for this gene. Most of these mutations are heterozygous. Most of these mutations are replacement mutations, of which the most common R426H mutation was identified in all families. The results of GWAS studies also indicate that there are many genetic variants called SNP single nucleotide differences that may be related to breast cancer susceptibility. Examination of these polymorphisms or individual genetic differences in different populations can greatly increase the detection power.

Linkage studies and GWAS over the past years have identified a large number of SNPs associated with breast cancer that have been assigned to specific loci, including the rs7816345 polymorphism near the ZNF703 gene. The rs7816345 polymorphism is an SNP in chromosome 8 human and is associated with breast size. This polymorphism is located in the chromosomal region of 8p11.23 and is commonly associated with estrogen receptor (ER) -dependent breast cancer with clinical implications. ZNF703 is the only gene close to this region, possibly an oncogenic stimulus of this hyperactivity (8). ZNF703 (Zinc finger protein 703) is a new oncogenic breast cancer oncogene and a prognostic marker and therapeutic target in ER positive (estrogen receptor) breast cancer. This gene is located in the chromosomal region of 8p12 ZNF703 exerts a downregulating effect on the β-TGF signaling pathway. It also cooperates with a form of p53 [8].

Another polymorphism associated with breast cancer is rs17001868 polymorphism

According to GWAS studies, the association of this polymorphism with mammographic density of breast cancer risk has been demonstrated. The rs17001868 polymorphism is located in the 22q.31 gene region of the SGSM3 gene. The SGSM3 gene is short for the term 3 Small G protein signaling modulator and is in fact a modulator of small G protein signaling [9]. The G family of proteins or proteins bound to guanosine nucleotide, are proteins that convert guanosine triphosphate GTP to guanosine diphosphate to GDP [10]. The SGSM3 gene is naturally expressed in immune, neural, muscular, and reproductive and many other tissues [10]. The class of protein gene products is a type of intracellular and membrane protein. Molecular function of this gene is as follows: GTPase17 activation and cell cycle arrest, intracellular transport of a vesicle protein from the plasma membrane to endosomes and then Rap protein signal transduction, Rap signal transduction (16 and regulation of vesicle fusion) [10-14]. The SGSM3 antibody is most expressed in normal breast tissue, whereas its expression is moderate in breast cancer tissue [6].

Therefore, considering that cancer, as one of the problems of the human society, by threatening human beings in all age groups, it causes great financial, vital, economic, social and familial burden. Among the different types of cancer, breast cancer is one of the most common and leading cause of death in the world and the second most common cancer after lung cancer in the world, and the main cause of cancer deaths in women, because of the link between breast cancer and SNP varies across populations and races. Assessment of the polymorphism complex for each specific population and race seems necessary, and any research on identifying the causes and causes of breast cancer in women can be of great help in the prevention and treatment of breast cancer. Therefore, the present study investigates the relation of rs3788577 polymorphism with ADSL polymorphism Vrfysm rs7816345 (near genes znf703) and Ply¬Mvrfysm 17001868 rs SGSM3 gene linked to breast cancer in the population Zrbayjan¬Shrqy to find any relation between this polymorphism and clinical characteristics Mvrfysm¬Ha in Iran.

Research Methodology

The present study was a case-control study to investigate the relation between ADSL- related rs3788577 polymorphism, rs7816345 rs7816345 polymorphism (near znf703 gene) and SGSM3-dependent rs 17001868 polymorphism in a population of women with breast cancer. The donor was taken to Tabriz Martyr Madani Hospital between April and May in the Genetic Laboratory of Azad University of Bonab. Blood samples were collected from 3 uninfected women and 3 women with breast cancer with complete consent of health and fertility data. Demographic data of patients referred such as age, sex, metastasis or not, etc. were obtained. From the ethical considerations, consent was obtained from patients and approved. Patients' information remained confidential. After obtaining consent from patients with breast cancer at Shahid Madani Hospital, 100 blood samples were collected and coded in oxalate (anticoagulant) tubes. Specimens prepared by cold chain preservation were transferred to the genetic laboratory of Bonab Azad University for laboratory research and stored at -21°C. Laboratory procedures were first performed for blood samples taken from patients according to the following steps. After the procedure was completed, all procedures for blood samples taken from healthy individuals were repeated.

Genomes were first extracted from blood samples from the target population. To extract DNA, all tubes and heads were sterilized with autoclave. Then DNA extraction was performed according to the protocol instructions. In this study, DNA was extracted from the DNA of the cina clone. Gelelectrophoresis technique was used to ensure the quality of the extracted DNA. Then the extracted DNA was amplified with specific primers for each polymorphism by PCR technique. The primers were designed with Oligo 7 software. The sequences of primers used in this study were as follows:

For PCR, primers F and R were diluted to a ratio of 5.1. An empty 0.5 ml microtube was prepared on ice and poured into 1 μL of F primer and 1 μL of diluted R primer. Then 12.5 μL of Master Mix and 9.5 μL of deionized water were transferred to the same microtubule and its contents were spin slowly for a short time, then 1 μL was transferred into the extracted DNA microtope contents and a short spin slowly spin was done. Finally, microtubes with a final volume of 25 μl were inserted into the PCR machine. After the samples were placed in a thermocycler, the device was adjusted to Table 1. To ensure the quality of the PCR product, the fragment was amplified on agarose gel 1. The% stained with ethidium bromide was electrophoresed (Tables 1-4).

Table 1: Sequences of primers used in the study (rs7816345 polymorphism).

Primer name Primer sequence Length
Forward '3 -TAGGAATATTTTGGGTTGTA-'5 20
Reverse '3-AATAAGGTGTGGAAGTTGTAA-'5 21

Table 2: Sequences of primers used in the study (ADSL gene rs3788577 polymorphism).

Primer name Primer sequence Length
Forward '3 -AAGAGGAAAGGAATAAAAA-'5 19
Reverse '3-GAGAAAGAGGAATGATGAGAT-'5 21

Table 3: Sequences of primers used in the study (SGSM3 gene rs17001686 polymorphism).

Forward Primer - 1 ATAAATGGAAGAACTGGTGGAATAT
Reverse
primer - 2
TCATGATGTGAAATGAGAGAATAAGA

Table 4: Time and temperature schedule of the PCR Device.

Number of cycles Time Temperature (°C) Stage
1 10 min 95 Primary
denaturation
34 1 min 95 Denaturation
1 min * Primer connecting
1 min 74 Elongation
1 5 min 74 Final elongation

Genotyping

The RFLP method was used to determine the genotype of rs7816345 polymorphism. The PCR product was subjected to TaqI restriction enzyme (Frementas Co.). Post-cut fragments were expected for genotype CC 152- 22 and genotype TC174-152-22 and for genotype TT174, respectively. PCR products were treated with Hpa II restriction enzyme (BsiS I) (MSP I). The fragments after enzyme cleavage were for genotype GG18-59-141, for GA18- 59-177-141 and for AA77-141 genotype, respectively. Waiting in order to observe and evaluate the rs17001868 polymorphism in the studied samples, the procedure was pre-treated and treated with SSPI enzyme, for AA genotype 23-135 for CC 158 and for AC genotype 15-135-15.

First, 10 microliters of the PCR product of one sample was poured into the microtube then 18 microliters of deionized water was added. It was also added 2 μL of buffer and 2 μL of restriction enzyme. It was then gently mixed with pipetting and the microtope lid was tightly closed and paraffin-embedded. These steps were repeated for other samples. Finally, the microtubes were incubated in bin Marie at 65°C for 16h. To investigate the effect of this enzyme, enzyme-treated products were observed by gel electrophoresis and gel staining.

Agarose gel was incubated in ethidium bromide solution for 20 minutes to see staining. Finally, the gel was transferred to the Trans Illuminator and bands containing cut DNA fragments were observed and photographed. At the end, all data were analyzed by SPSS version 21 using descriptive and chi- square tests and significance level less than 0.05 was considered significant.

Findings

Patients' demographic data were obtained from the hospital, including information such as patient age, patient sex, metastasis or non-metastatic, bilateral or unilateral, cancer, pregnancy and delivery records, lactation history, disease progression. In terms of gender, 2 blood samples from female patients with breast cancer and 3 healthy blood samples were selected as the control group. The other factors mentioned above were not included in the results due to disapproval from Tabriz University of Medical Sciences. Chi-square test was performed on the data of frequency of genotypes (Table 5).

Table 5: Chi-square test results to compare the frequency of two groups of patient and healthy according to genotypic variable classes.

Variables Types Group Chi square P-value
Healthy Diseased
Rs7816345   TT 39 61    
polymorphism Genotype CC 50 22 17/015 0
(near znf703
gene)
  TC 11 17    
Rs17001868   AA 12 18    
polymorphism Genotype CC 82 75 1/5 0.45
(related to
SGSM3 gene)
  AC 6 7    
Rs3788577   AA 77 24    
polymorphism Genotype GG 6 41 60/106 0
(related to
ADSL gene)
  AG 17 35    

The results of chi-square test showed that the significant values in rs7816345 and rs3788577 were equal to zero. Therefore, it can be generally said that there is a significant difference between the frequency of genotypes between the healthy group and the patient group. (P < 0.05) while the results showed that in rs17001868 between healthy and diseased individuals, CC genotype had the highest and AC genotype had the least frequency and the significant value (P) was 0.45. The results showed that there was no significant difference (P > 0.05) between genotype and patient group in frequency of genotypes at rs17001868.

The results also showed that among healthy people, rs3788577 had the highest AA genotype and the lowest GG genotype, and the sick GG genotype had the highest frequency and the lowest AA genotype. The frequency of AA, GG and AG genotypes was significantly different in healthy and diseased individuals (P < 0.05).

Conclusion

All the aforementioned studies and the results of our study show that the presence of different polymorphisms can contribute to the development of susceptibility to diseases such as breast cancer, depending on the race and geographical position. Depending, the discovery of this relationship requires further studies. The types of polymorphisms that cause genetic variation that determine phenotypic variation among individuals appear to be involved in susceptibility to disease and disease progression. Given that gene polymorphisms are one of the risk factors for breast cancer and because these gene polymorphisms show different distribution in different geographical communities and regions, therefore, the study candidate gene variants in different populations are needed to find out their association with breast cancer, and given that current methods of treating various cancers have serious consequences, discovering new methods for early detection. The disease can open new therapeutic horizons by identifying specific biomarkers for that type of cancer.

References

Google Scholar citation report
Citations: 3919

Molecular and Genetic Medicine received 3919 citations as per Google Scholar report

Molecular and Genetic Medicine peer review process verified at publons

Indexed In

arrow_upward arrow_upward