GET THE APP

Diagnosis of Pneumocystis jirovecii Pneumonia by Real Time PCR: An Analysis of 10 Clinical Cases
Medical Microbiology & Diagnosis

Medical Microbiology & Diagnosis

ISSN: 2161-0703

Open Access

Research Article - (2021) Volume 10, Issue 2

Diagnosis of Pneumocystis jirovecii Pneumonia by Real Time PCR: An Analysis of 10 Clinical Cases

Baccouchi Nawel1,2*, Mtibaa Latifa2, Souid Hana1,2, Mehiri Emna3, Slim Leila3 and Jemli Boutheina2
*Correspondence: Baccouchi Nawel, Department of Biology, Faculty of Sciences of Tunis, Laboratory of Parasitology, Military Hospital of Tunis, UR12DN03, Tunis, Tunisia, Tel: 27186634, Email:
1Department of Biology, University of Tunis, Tunis, Tunisia
2Department of Parasitology, Military Hospital of Tunis, Tunis, Tunisia
3Department of Microbiology, Hospital Abder-Rahmenmami of Pneumo-Physiology, Ariana, Tunisia

Received: 08-Jan-2021 Published: 01-Feb-2021 , DOI: 10.37421/2161-0703.2021.10.313
Citation: Nawel, Baccouchi, Latifa Mtibaa, Hana Souid and Emna Mehiri, et al. ‘‘Diagnosis of Pneumocystis jirovecii Pneumonia by Real Time PCR: An Analysis of 10 Clinical Cases’’. J Med Microb Diagn 10 (2021): 313.
Copyright: © 2021 Nawel B, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Abstract

Introduction: Pneumocystis jirovecii Pneumonia (PCP) is a life-threatening disease in immunocompromised patients. The aim of this work is to demonstrate the contribution of molecular biology in diagnosis compared to conventional methods and we propose an adapted cut-off value for differentiating Pneumocystis colonization from infection using real-time PCR.

Methodology: This was a prospective study enrolled from April 2015 to December 2018 at the Laboratory of parasitology of Military Hospital of Tunis. All pulmonary secretions samples were analyzed using: May-Grunwald-Giemsa (MGG) and Gomori Grocott Modified MUSTO Coloring Technology (GG). Optimization of conventional PCR and real-time PCR were accomplished.

Results: During the study period, we collected 200 samples. The prevalence of the disease was 5% (10/200). MGG coloring didn’t discern vegetative forms of Pneumocystis jirovecii for all samples. Cysts were visualized by GG coloring for seven samples. Conventional PCR and Realtime PCR were positives for 10 samples with quantity of DNA going from one copy to 104 copies per milliliter.

Conclusion: Molecular biology is more sensitive than techniques of coloring. Currently real-time PCR gives at the same time a quantitative and qualitative approach with a threshold of detection very low which allows differentiating between a simple colonization and an infestation.

Keywords

Pneumocystis jirovecii • PCP • Real-time PCR • Diagnosis

Introduction

Database about Pneumocystis jirovecii Pneumonia (PJP) in humans shows an important rate of morbidity and mortality among immunocompromised patients [1-3]. This microbe affects patients with Human Immunodeficiency Virus (HIV), as well as hematological malignancies [4], solid organ transplantation, solid tumors, and immunosuppressive treatments [5]. The identification of P. jirovecii is mainly based on microscopic coloration methods and immunofluorescent staining [6,7]. Sensitivity of the staining techniques is acceptable for Broncho-Alveolar Lavage (BAL) specimens [8]. Various PCR protocols, including conventional PCR, nested PCR and real-time PCR [9-11], have been published and evaluated. They offer a qualitative and quantitative detection of the P. jirovecii DNA in a clinical sample even at low levels. Moreover, molecular detection of P. jirovecii in less-invasive specimens has also been shown to be cost-effective. In this study, we aimed to compare sensibility and specificity of different techniques (standard staining, conventional PCR and real-time PCR) used in the diagnosis of PCP. We propose an adapted cut-off value for differentiating Pneumocystis colonization from infection using realtime PCR.

Materials and Methods

Specimen’s collection

Throughout four years (2015-2018), we collected pulmonary samples from 200 patients, including 74 (37%) broncho-alveolar lavages, 62 (31%) sputum and 64 (32%) protected tracheal sampling requiring a specific P. jirovecii investigation. These specimens were received from hospitalized patients in the Military Hospital of Tunis and Abdelrahmen-Mami Ariana Hospital. Patients’ clinical characteristics are presented in Table 1. Suspicion of PCP was based on epidemiological, clinical and radiological findings. Symptoms considered to be common during PCP were: progressive dyspnea, non-productive cough, and low-grade fever, hypoxemia. Radiological signs considered to be associated with PCP were bilateral perihilar interstitial infiltrates. Respiratory specimens were centrifuged at 6000 g for 10 min. Part of the suspended pellet (about 200 μl) was used for microscopic examination (MGG, GG stains) and 200 μl was used for PCR (conventional PCR and real-time PCR).

Conventional techniques-microscopy

MGG and The MGG stain highlights intra-cystic bodies and/or trophozoites of P. jirovecii. Indeed Giemsa stains the nucleic of all Pneumocystis life cycle stages in purple pink but does not stain the cell wall. While the Gomori stains the wall of cysts of P. jirovecii in black brown on a green background.

Molecular diagnosis

DNA extraction: DNA was extracted by the Enro Gold Tissue DNA Mini Kit (EuroClone®, Italy) according to the manufacturers' recommendations. The extracts are either directly amplified or stored at -20°C for subsequent PCR.

Conventional PCR: PCR was performed according to Mei et al., [12]. The PCR mixture (50 μl) contained 2 mM of each primer, JKK14 (5'GAATGCAAATCCTTACAGACAACAG3') and JKK17 (5'AAATCATGAACGAAATAACCATTGC 3'), derived from the surface glycoprotein gene of Pneumocystis jirovecii, 0.2 mM dNTPs, 4.5 mM MgCl2, 1 concentrated PCR buffer, 1.25 U Taq DNA polymerase and 100 ng of purified DNA. The reaction mixture was initially incubated for 15 min at 95°C. Amplification was performed by 40 cycles of denaturation (95°C for 30 s), annealing (56°C for 1 min), extension (72°C for 30 s) and the finally extension (72°C for 5 min). The PCR amplification products (249 bp fragments) were subjected to electrophoresis in 1.5% agarose gel in Tris-borate-EDTA buffer and detected after staining with Red safe under UV illumination. We used DNA extracted from trophozoites and / or cysts of P. jirovecii as a positive control and the water as a negative control. All positive samples were tested twice.

Real-time PCR: LiferiverTM Pneumocystis jirovecii® real-time PCR kit allows specific amplification of P. jirovecii DNA using two specific probes labeled with different fluorochromes (FAM for P. jirovecii and HEX for the internal control). The reaction is carried out in a total volume of 40 μl contained 4 μl DNA, 1 μl Internal Control, 35 μl Tampon Mix and 0.4 μl Enzyme Mix. The kit has a positive control (107 copies ml-1) that can be diluted to achieve a seven-point range (107 to 101 copies ml-1). The amplification is carried out on the automat LigthCycler® 480 II (Roche) according to the recommended amplification program. The reaction Mixture was initially incubated for 2 min at 37°C (1 cycle) and 2 min at 94°C (1 cycle). Amplification was performed by 40 cycles: 15 sec at 93°C and 1min at 60°C. The results are rendered in number of Cycle Threshold (Ct) and in number of copies per millilitre when the quantization range is achieved. Clinical, biological, radiological, treatment, and prognostic data of all patients were collected. The diagnosis of pneumocystosis was considered as:

•Confirmed PCP=Positive direct examination;

•Possible PCP=Negative direct examination and PCR positive: clinical and/or para-clinical features indicative of PCP, and completer solution of symptoms following curative anti-PCP treatment.

•PCP ruled out, classified as colonization=Negative direct examination and PCR positive: Identification of another etiology responsible for the observed respiratory symptoms, and absence of curative anti-PCP treatment.

Statistical analysis

Statistical analyses were performed using SPSS 22.0. The accuracy of the real-time PCR assay was measured by the area under the Receiver Operating Characteristic (ROC) curve. The odds ratio (OR) and 95% confidence intervals (95% CI) were used to describe associated factors.

Results

Patients’ characteristics

From April 2015 to December 2018, 200 samples were received from patients suspected to have Pneumocystosis. A total of 200 patients were included in this study. The molecular detection of Pneumocystis jirovicii was confirmed for only 10 patients (5%). There were six male and four female. Their From April 2015 to December 2018, 200 samples were received from patients suspected to have Pneumocystosis. A total of 200 patients were included in this study. The molecular detection of Pneumocystis jirovicii was confirmed for only 10 patients (5%). There were six male and four female. Their median age was 62 years (ranging from 47 to 77 years old). They suffer from Hematological malignancies (3/10; 30%), solid organ transplantation (2/10; 20%) and inflammatory diseases (2/10; 20%). Clinically, fever and dyspnea were observed in 70% of these patients and cough in 10% of them. Bilateral diffuse interstitial infiltrate was observed in 70% of cases. The mortality rate was 1%.

Biological diagnosis and results interpretation

Microscopic Examination (ME) was positive for 7/10 patients (70%), revealing cysts of P. jirovecii in 5broncho-alveolar lavages, and one sputum and protected tracheal sampling each. Molecular diagnosis was positive for all patients [10] (Figure 1). The sensitivity of the PCR was 6.7% for bronchoalveolar lavages (5/74); 4.8% for sputum (3/62) and 3.1% for protected tracheal sampling (2/64) and the specificity was 100%. Patients with positive PCR are suffering from at least one symptom (fever, dyspnea and cough). Thirteen percent of them present all the 3 symptoms, 20% present 2 symptoms, 30% present one symptom and 20% of patients are asymptomatic. The ME positivity was 10% for patients presenting one symptom and was about 20% for other category of patients each. The ME positivity was 20% for patient with no symptoms, two symptoms and three symptoms each and 10% for one symptom. Conventional PCR detected a 249 bp band for 10 samples (Figure 2). Similarly, the real-time PCR was positive for 10 samples and the quantity of DNA varies from one copy to 104 copies per ml (Figure 3 and Table 1). The sensitivity of molecular biology was 100% and the specificity was 98%. The positive predictive value was 70% and the negative predictive value was 100%. The ROC curve (Figure 4) represents the sensitivity and the 1-specificity of the different Cycle Threshold (Ct) of the real-time PCR assay compared with the ME method. The area under the ROC curve was 0.990 with a 95% confidence interval [0.997-1.000].

Table 1: Results of techniques used for the ten patients infected with Pneumocystis.

No. Sex Patient’s history age Sample Grocott and/or MGG coloring Conventional PCR Real time PCR (CP) Radiology HIV Serology Treatment
copies/ml
1 W Renal transplant +infectious neumonia 53 Sputum   + + (36)/102 - - NS
2 M Myeloma 60 BAL   - + (38)/10 - -  
3 M Lymphoma 67 Tracheal sampling   - + (38)/10 - - NS
4 W Infectious pneumonia 66 BAL   + + (35)/102 + - NS
5 W Lymphoma 51 BAL   + + (30)/104 + - NS
6 M Rénal transplant+Infectious pneumonia 47 Tracheal sampling   + + (33)/103 + - NS
7 W Inflamatory disease 77 Sputum   - + (34)/102 + - NS
8 M

Renal transplant

56 Sputum + + (34)/102 + - Trimethoprim/
Sulfamethoxazole
 
9 W Inflamatorydisease 48 BAL   + + (33)/103 + -  
10 M Infectious pneumonia 50 BAL   + + (29) 104 + - NS
Cysts

Figure 1. Cysts of Pneumocystis jirovecii colored by Gomori-Grocott modified by MUSTO.

Agarose

Figure 2. Agarose gel electrophoresis of conventional PCR products of P. jirovecii MSG gene.

Lanes: M, 100 bp DNA size marker.; 1, negative control ; 2, positive control ; 3, 5, 6 and 7, positive clinical samples having specific 249 bp bands representative of P. jirovecii positive; 4, negative clinical samples.

PCR

Figure 3. Efficiency of the real-time PCR assay for the identification of P. jirovecii.

Positive control dilution series were used to create calibration curves for the calculation of DNA concentrations of Pneumocystis jirovecii in positive samples. The upper curve shows the amplification curves; A1 to A6: standards with a DNA concentration of 107 to 102 copies/μl; A9 to B11: The samples tested; B12: Negative control. The lower curve shows the standard curve constructed from the values of Cp (crossing point) versus the log DNA copy number / (range = 107 to 102 copies/μl).

ROC

Figure 4. ROC curve of the real-time PCR assay for the diagnosis of P. jirovecii compared with the ME.

The best sensitivity of the real-time PCR technique was for Ct ≥ 38 (100%) and the best specificity for Ct ≤ 30(100%), using ME as a reference technique. Between these two points of cut, there was a gray area in which the results of the PCR and the ME may differ. According to the PCR cycle thresholds previously described, patients could be divided into three groups, group with "Ct ≥ 38" (two patients), group with "30 < Ct < 38"(7 patients) and group with "Ct ≤ 30" (two patients). For the two patients of the group with "Ct ≥ 38", the ME was negative with a positive PCR and the quantity of DNA was less than 102 copies per ml. They have developed clinical signs of PJP (fever, dyspnea and cough) with absence of an interstitial radiological syndrome. Compared to this group, the two patients including in the group with "Ct ≤ 30" presented in addition to clinical signs, interstitial syndrome in imaging. The ME was positive with a quantity of DNA greater than or equal of 104 copies per ml. For the five patients in the group with "30 < Ct < 38", the quantity of DNA varies between 102 copies per ml and 104 copies per ml. In conclusion, eight patients were selected for developing PJP, and two were colonized (Table 2).

Table 2: Description and bivariate analysis of the 10 included patients.

    PCR results ORa ORb
[95 Cl] [95 Cl]
    Ct ≥ 38 30<Ct<38 Ct ≤ 30
N=2 N=6 N=2
  Male 1 3 1 NS NS
Sex Woman 1 3 1 NS NS
Age >47 2 5 2    
  Myéloma 1 0 0 NS NS
  Lymphoma 1 1 0 NS NS
Chronic Disorders Organ transplantation 0 0 2 NS NS
  Inflammatory disease 0 2 0 NS NS
  Sputum 0 2 1 NS NS
Sample type PTP 1 1 0 NS NS
  LBA 1 3 1 NS NS
Fever (n=) >39°C 2 3 2 NS NS
Cough (n=) Yes 0 0 1 NS NS
Dyspnea (n=) Yes 1 5 1 NC NC
Interstitial Syndrome (n=) Yes 0 3 2 NS NS
Interpretation   Colonized PJP PJP    
Probable

Discussion

PJP is an opportunistic infection responsible for severe interstitial lung disease in immunocom promised patients. Pneumocystis, which was initially very rare, saw its incidence explode since 1980 with the onset of the epidemic caused by HIV. Currently, cases of pneumocystosis in HIV-infected patients tend to decrease due to the use of anti-Pneumocystis jirovecii chemoprophylaxis on the one hand and antiretroviral treatments which allow a better control of immune depression on the other hand [13,14]. The prevalence of PJP in our study is 5%. For Issa et al., 2018 7% have been developed pneumocystosis, of which 25% were HIV+ (38/150 patients) [15]. Dieng et al., founded that of 20 patients with pneumocystosis (9%) only 4 are HIV+ [16]. This frequency is less than reported in another Tunisian study of kaouech et al., 2009 (29.6%) where the majority of cases are HIV+ (11/15) [17]. Furthermore in Ethiopia, the prevalence of the PJP was 42.7% and all patients were HIV+ [18]. This difference could be due to a difference in the virulence of genotypes circulating in these countries and the improvement of identification techniques. In our study, the median age was 62 years and 59 years as reported by Issa et al., in 2018 and Teh et al., in 2014 respectively [19]. Similarly, we noted a male predominance in 60% of cases with a sexratio of 1.5. This masculine predominance was found in 68.9% and 70% of the considered populations reported by Teh et al., [20], Issa et al., respectively. At present, most of our patients (70%) present dyspnea and fever. Similarly, for Tech et al., clinical symptoms included shortness of breath (64.4%), cough (48.9%) and fever (42.2%). Issa et al., 2018 reported that the most common symptoms were dyspnea (85%), cough (83%), hyperthermia (85%), and deterioration of general status (82%).

Confirmation of PJP diagnosis relies on the detection of cysts and/or trophozoites (GG and/or MGG staining) of P. jiroveciiat direct examination of respiratory secretions. The sensitivity of this usual examination in case of PCP in HIV-infected patients ranges from 80% to 100%, irrespective of the type of sample collection method [21]. The sensitivity of the direct examination in non- HIV-infected patients ranges from 50% to 70% when BAL is performed [22,23]. At present, to ameliorate the diagnosis of PJP many molecular tests have been described and recently real-time PCR was used. Kaouech revealed a positive PCR in 14 cases in which only 5 cases were positive by conventional methods. This can be explained by the lack of sensitivity of the microscopic methods and by the difficulty of reading when the samples are non-invasive or superficial. Currently, several studies have shown that molecular biology techniques are more sensitive than conventional techniques for diagnosing PCP [24,25].

Endpoint PCR is a qualitative approach which had a very high sensitivity compared to GG staining. It is faster and easier than conventional techniques but it is a long technique and susceptible to contamination comparing to real time PCR. Our study presents the first real-time PCR assessment in the routine diagnosis of P. jirovecii in Tunisia. The Light Cycler 480 real-time PCR can be used with a large number of samples with a well-defined standard range. The results can be obtained within 1.5 hours. The sensitivity of real time PCR reaches 100% whereas it is only 85.17% for microscopy techniques [15,22]. In addition, real-time PCR used an internal control for the detection of PCR inhibitors. The main advantage of real-time PCR is the simultaneous completion of the amplification and detection steps in a closed system, which reduces the risk of contamination. The positive controls of the real-time PCR also have a well-defined quantification (107 copies ml-1). In addition, it allows detecting the DNA even in a small amount so we can clearly specify whether it is a simple colonization or an infection [26-28]. One of the disadvantages of this technique is the realization of the quantization range by successive dilutions of the positive control. This manipulation can generate dilution errors as well as contaminations at the origin of an erroneous quantification range. Our study can separate the population in to three groups and to propose three interpretations to clinicians:

Negative PCR results: “Absence of P. jirovecii. PJP diagnosis excluded”.

Positive PCR with Ct ≥ 38: “Low fungal burden: Pneumocystis pneumonia improbable. Prophylactic treatment could be necessary in case of an immunocompromised patient”

Positive PCR with 30 ˂Ct ˂ 38: PJP probable. The diagnosis of PJP or colonization depends on patient history, biological and radiological, treatment, and patient clinical evolution.

Positive PCR with Ct ≤ 30: PJP.

This study showed that P. jirovecii was detected by PCR in all cases where the ME was positive. The sensitivity and the specificity of the real-time PCR depended on the Cycle Threshold (Ct) of detection. If the Ct ≥ 38 the sensibility was 100%, on the other hand if the Ct ≤ 30 the specificity was 100%. Between these two points, there was a grey zone in which the PCR value and the ME result could be different. Several studies have shown that PCR to be more sensitive than the standard diagnostic methods ME [28]. In our study, P. jirovecii was detected in Tracheal sampling of patient No. 3 (Ct 38). Therefore, real-time PCR offers evidence of Pneumocystis carriers (simple colonization), especially since conventional techniques in this patient were negative but with a mycological culture positive to Aspergillus fumigatus and Candida albicans. Another sample of patient No. 1 was positive in GG staining and real time PCR (Ct 36) with mycological culture positive to Aspergillus fumigatus and Candida albicans. Despite the fact that the quantification of the DNA was in favor of colonization, the patient received treatment against Pneumocystis, taking into account his history. But he was resistant to treatment and the evolution was quickly fatal. Indeed, the curative management of PJP is based on a consensus, but the management of colonized patients is not; the benefit of primary prophylaxis for PCP in non-HIV-infected immunosuppressed patients is therefore not confirmed. As for the non-HIV-infected patients, the risk of PJP depends on the type of immunosuppressant. The expected benefit of a cotrimoxazole prophylaxis must therefore be balanced against the risk of severe adverse [28].

Conclusion

The use of molecular biology in addition to microscopy techniques is of real interest for the diagnosis of PJP. The development of real-time PCR has emerged as a major breakthrough in molecular biology. It allows a gain of sensitivity in the detection of P. jirovecii and a better estimation of PJP, making it a technique of choice for routine use within the laboratory.

Declarations

Funding: Not applicable.

Conflict of interest: The authors declare that they have no conflict of interest.

Ethical approval: For this type of study formal consent is not required.

Acknowledgments: The authors would like to thank Slim Leila and Mhiri Emna, Microbiology Laboratory at Abdelrahmen Mami Hospital, for the selection of samples.

Other contributions: We thank biologists and technicians, Parasitological Laboratory at Military Hospital of Tunis, for their help in data acquisition.

References

Google Scholar citation report
Citations: 14

Medical Microbiology & Diagnosis received 14 citations as per Google Scholar report

Medical Microbiology & Diagnosis peer review process verified at publons

Indexed In

arrow_upward arrow_upward