GET THE APP

Association of Serum and Tumor Tissue microRNA Profile with Aggressiveness of Papillary Thyroid Carcinoma in an Iranian Population
Journal of Molecular Biomarkers & Diagnosis

Journal of Molecular Biomarkers & Diagnosis

ISSN: 2155-9929

Open Access

Research - (2021) Volume 12, Issue 1

Association of Serum and Tumor Tissue microRNA Profile with Aggressiveness of Papillary Thyroid Carcinoma in an Iranian Population

Sara Nazari1, Ahmad Majd1, Iraj Heydari2, Mohammad Reza Mohajeri Tehrani3 and Reza Nekouian4*
*Correspondence: Reza Nekouian, Pediatric Growth and Development Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran, Email:
1Department of Cellular and Molecular Biology, Faculty of Biological Sciences, Islamic Azad University, North Tehran Branch, Tehran, Iran
2Endocrine Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran
3Endocrinology and Metabolism Research Center, Endocrinology and Metabolism Clinical Sciences Institute, Tehran University of Medical Sciences, Tehran, Iran
4Pediatric Growth and Development Research Center, Institute of Endocrinology and Metabolism, Iran University of Medical Sciences, Tehran, Iran

Received: 14-Dec-2020 Published: 29-Jan-2021 , DOI: 10.37421/2155-9929.2021.12.448
Citation: Sara Nazari, Ahmad Majd, Iraj Heydari and Mohammad Reza Mohajeri Tehrani, et al. “Association of Serum and Tumor Tissue microRNA Profile with Aggressiveness of Papillary Thyroid Carcinoma in an Iranian Population.” J Mol Biomark Diagn 12 (2021): 448.
Copyright: © 2021 Nazari S, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Abstract

Objectives: Papillary thyroid carcinoma (PTC) is the most common malignancy of thyroid. We aimed to investigate the association of let-7f, miR-146b-5p, miR-34b, miR-16 and miR-877-5p expression in blood circulation and tumor with aggressiveness of PTC.

Methods: A total of 18 patients with aggressive PTC and 18 patients with non-aggressive PTC were studied. The microRNAs expressions were evaluated using real-time PCR. Fold changes (FC) of the miRs in aggressive PTC patients were calculated via calibration with mean of expression of the miRs in non-aggressive groups.

Results: MiR-16 showed significant up regulation in blood (FC=2.85; P=0.024), miR-34 showed significant down regulation in blood (FC=0.19; P<0.001) and tumor tissue (FC=0.19; P<0.001), miR-146 showed significant up regulation in blood (FC=48.10; P<0.001) and tumor tissue (FC=60.61; P<0.001), miR-877 showed significant down regulation in blood (FC=0.22; P<0.001), and let-7 showed significant down regulation in blood (FC=0.09; P<0.001) and tumor tissue (FC=0.13; P<0.001).

Conclusion: In general, our study in an Iranian population supported the previous results. Up regulation of miR-146 was associated with aggressiveness of PTC.

Keywords

Papillary thyroid carcinoma • microRNA • Aggressive tumormir-146b

Introduction

Papillary thyroid carcinoma (PTC) is the most common malignancy of thyroid gland originating from thyroid follicular cells. PTC has generally a good survival rate; however the cases having certain clinico-pathological parameters have poorer prognosis [1]. A population-based cohort study showed that incidence of total thyroid cancers increased from 3.6 per 100000 in 1973 to 8.7 per 100000 in 2002. No significant change was reported for incidence of the less common types including follicular, medullary, and anaplastic carcinomas. In other words the entire increase is attributable to an increase in incidence of PTC, which increased from 2.7 to 7.7 per 100000. Crude death rate of PTC was approximately 0.5 deaths per 100000 individuals from 1973 to 2002 [2]. Point mutations in proto-oncogenes including rearranged during transformation (RET), BRAF, V-Raf and rat sarcoma viral oncogene homolog (RAS) were frequently observed in PTC [3].

microRNAs (miRs) are endogenous single stranded non coding RNAs that bind to the 3' non coding region of the target mRNAs, resulting in their selective degradation or inhibition of translation. Therefore miRs are involved in regulation of biological functions [4]. Let-7 family is known as the first group of discovered miRs in human. It has been observed that down regulation of these miRs is associated with malignancies [5]. Let-7 miRs bind to RAS oncogenes and result in their down regulation. Therefore they have been investigated in PTC. In addition, this family has been observed in normal thyroid gland suggesting that it may play a role in function of thyroid gland [6]. Other than let-7 family, other miRs were notable. MiR-146b regulates signal transduction of transforming growth factor-beta (TGF-β) and therefore may play a role in PTC. In addition, oncogene activation has resulted in increase in expression of miR-146b [7].  It has been observed that patients with BRAF mutation have a higher expression level of miR-146b in comparison to patients with wild type of BRAF [8]. MiR-34b is involved in oncogenesis. In has been observed that it was down regulated in cancer cells [9]. A study on different cancer cell lines showed that many genes such as RAS family are targeted by miR-16 [10]. MiR-877 is another cancer related miR which is down regulated in hepatocellular carcinoma via targeting cyclin dependent kinase (CDK) 14 [11].

Previously diagnostic role of miRs in PTC have been investigated [12]. However, other than diagnosis, it is important to have ability to differentiate aggressive cases from the non-aggressive ones. Therefore, the present study was designed to investigate the association of let-7f, miR-146b-5p, miR-34b, miR-16 and miR-877-5p expression in blood serum and tumor tissue with aggressiveness of PTC in an Iranian population.

Materials and Methods

Study design and patients

The present work was a case control study to compare blood and tumor tissue expression of the miRs between aggressive and non-aggressive patients of PTC using reverse transcriptase quantitative polymerase chain reaction (RT-qPCR). A total of 18 patients with aggressive PTC were considered as the case group and 18 patients with non-aggressive PTC were considered as the control group. The samples were collected from 3 centers Toos, Shariyati and Firoozgar (Tehran, Iran) from February to September 2019 through convenient sampling. This study was approved by the ethics committee of Shariyati hospital (IR.TUMS.EMRI.REC.1398.008). Written informed consents were obtained from all the participants.

Blood and tumor tissue samples collection

Fresh tissue specimens of aggressive and non-aggressive PTC tissues were obtained from tumors and immediately kept at -80°C until analysis. All the samples were diagnosed by two independent pathologists. Confirmation of PTC was through light microscope using hematoxylin and eosin staining. Clinical staging was according to prognostic factor for recurrence in N1b [13]. From each participant, 2 ml of peripheral blood was collected in EDTA containing tubes and immediately kept at -80°C until analysis.

Total RNA extraction

Total RNA was obtained from the tumors and serum with columnar extraction method using total RNA purification kit (Norgen, Canada) according to the manufacturer's instructions. Total RNA quantification was performed using nanodrop spectrophotometry (Thermo Scientific Wilmington, DE, USA). Sample quality control using cel-mir-39 Spike-In Kit (Norgen, Canada) offers a quantified synthetic RNA (cel-miR-39) for spike-in during RNA extraction procedures and subsequent normalization in RT-qPCR assays. The amount of cel-miR-39 RNA recovered after RNA extraction is directly correlated with the amount of total RNA recovered. Therefore cel-miR-39 was used as the reference to report ∆Ct.

miR reverse transcriptase PCR

cDNA was synthesized with poly A polymerase method using microScript microRNA cDNA Synthesis kit (Norgen, Canada). Then the cDNA was subjected to be used for real-time reverse transcriptase polymerase chain reaction (RT-PCR) using SYBR Green mastermix (Norgen, Canada) according to the manufacturer's instructions (after a first 30 min at 37°C, then 30 min at 50°C and finally 15 min at 70°C). All RT-PCR reactions were performed in triplicates. Levels of miR expression were calculated by relative quantification using Rotor Gene Q Real-Time PCR SDS 2.3.1 software (Applied Biosystems Inc., Foster city, CA). The results were presented as normalized Ct values. Previously published literatures were used for primary selection of the miRs. miR cancer database was used to find associations of miRs with cancers according to the literatures of PubMed. The candidate miRs were let-7f, miR-146b-5p, miR-34b, miR-16 and miR-877-5p. Mirbase database was used to find the sequences of the miRs in order to convert them to primer sequence. The used primers are shown (Table 1). miRDB database was used to find the targeted genes. According to this, these miRs can target RAS and Braf. Mirandola database was used to understand whether the miRs could be detected in circulating blood and the tissue. Bioinformatics characteristics of the used miRs are shown (Table 2).

Table 1: Sequences of the primers used in this study.

miR Primers
Mir16-5p TAGCAGCGTAAATATTGGCG
Mir34b-5p TAGGCAGTGTCATTAGCTGATTG
Mir146b-5p TGAGAACTGAATTCCATAGGCTG
Mir877-5p GTAGAGATGGCGCAGGG
Let7f-5P TGAGGTAGTAGATTGATAGTT

Table 2: Bioinformatics of the used miRs.

MicroRNA Location Target Score Position Sequence
Mir-16-5p Chr 13: 50,048,973-50,049,061 PLSCR4 70 1568-1575 of PLSCR4 3' UT R UAGCAGCACGUAAAUAUUGGCG
ANO3 98 2517-2523 of ANO3 3' UTR
PHF19 100 1377-1383 of PHF19 3' UTR
AQP11 65 227-234 of AQP11 3' UTR
Mir-146b-5p chr10: 102,436,512-102,436,584 NOVA1 98 682-689 of NOVA1 3' UTR UGAGAACUGAAUUCCAUAGGCUG
TRAF6 100 1272-1279 of TRAF6 3' UTR
CD80 90 839-846 of CD80 3' UTR
SEC23IP 99 3634-3641 of SEC23IP 3' UTR
Mir-877-5p chr6: 30584332-30584417 ZNF174 89 329-336 of ZNF174 3' UTR GUAGAGGAGAUGGCGCAGGG
TP53INP2 80 3069-3075 of TP53INP2 3' UTR
RP11-204N11.1 80 2289-2296 of RP11-204N11.1 3' UTR
TMCC2 67 1200-1207 of TMCC2 3' UTR
Mir-34b-5p chr11: 111512938-111513021 TENM1 100 1314-1321 of TENM1 3' UTR UAGGCAGUGUCAUUAGCUGAUUG
ELMOD1 98 1100-1106 of ELMOD1 3' UTR
RFX3 98 3622-3628 of RFX3 3' UTR
DLL1 97 294-300 of DLL1 3' UTR
Let-7f-5p chr9: 94176347-94176433 STARD13 100 Position 2362-2368 of STARD13 3' UTR UGAGGUAGUAGAUUGUAUAGUU
C14orf28 100 437-444 of C14orf28 3' UTR
LIN28B 100 44-51 of LIN28B 3' UTR
BZW1 92 84-90 of BZW1 3' UTR

Statistical analysis

Rest 2009 was used to investigate relative expression. Fold changes of each miR were calculated via the formula 2-∆∆CT in Excel 2013 calibrating with the mean of expression in non-aggressive PTC patients. Significance of individual fold changes was investigated with one sample t test (fold change=1 was the null hypothesis) and comparison of the fold changes between blood serum and tumor tissue was through independent t test. SPSS 24 software (IBM, US) was used for data analysis. Two-tailed P value less than 0.05 was considered as the significance level.

Results

A total of 36 Iranian patients of PTC with age range 20-72 were investigated. The range of the tumor size among the PTC patients was 0.5-8.0 cm with number of lymph node metastasis ranged 0-5 (Table 3). Real-time RT-PCR was performed and after approving the melting curves, fold changes were compared between blood serum and tumor tissue expression. Up regulation and down regulation of the miRs based on relative expression were calculated with rest program. This relative expression was calculated for expression of the miRs as aggressive versus non-aggressive groups (Table 4). Fold changes of the miRs in aggressive PTC patients were calculated via calibration with mean of expression of the miRs in non-aggressive groups using one sample t test. According to this, MiR-16 showed significant up regulation in blood (fold change [FC]=2.85; P=0.024), miR-34 showed significant down regulation in blood (FC=0.19; P<0.001) and tumor tissue (FC=0.19; P<0.001), miR-146 showed significant up regulation in blood (FC=48.10; P<0.001) and tumor tissue (FC=60.61; P<0.001), miR-877 showed significant down regulation in blood (FC=0.22; P<0.001), and let-7 showed significant down regulation in blood (FC=0.09; P<0.001) and tumor tissue (FC=0.13; P<0.001). Fold change of each miR (blood expression versus tumor tissue expression) was compared using independent t test. MiR-16 showed a significant more up regulation in aggressive PTC patients (2.85 vs. 0.92; P=0.020). No significant difference was observed between blood and tumor tissue fold changes for other miRs (Table 5 and Figure 1).

Table 3: Clinico-pathological features of the participants.

Variables Group 1 (Aggressive PTC) Group 2 (Non-aggressive PTC)
Gender
Female 13 13
Male 5 5
Age
45› 4 6
45‹ 14 12
Pathological characteristics
Metastatic lymph node 03-May 0-4
Tumor size 2.5-8 cm 0.5-4 cm
TNM staging III, IV, V I, II
Lobectomy 2 3
Thyroidectomy 16 15

Table 4: Comparison of relative expressions with their 95% confidence intervals are shown. *Significant at P<0.05.

miR Source Relative expression (95% CI) P value (Rest) Effect direction
Mir16-5p Tissue 1.206 (0.206-6.571) 0.407 Non-significant
Blood 1.162 (0.214-5.852) 0.485 Non-significant
Mir34b-5p Tissue 0.289 (0.010-4.225) 0.001* Down regulation
Blood 0.294 (0.018-5.513) 0.002* Down regulation
Mir146b-5p Tissue 6.834 (1.007-62.775) <0.001* Up regulation
Blood 4.289 (0.350-35.198) <0.001* Up regulation
Mir877-5p Tissue 1.096 (0.082-13.296) 0.774 Non-significant
Blood 0.858 (0.056-20.990) 0.661 Non-significant
Let7f-5P Tissue 0.555 (0.065-4.324) 0.028* Down regulation
Blood 0.108 (0.012-1.253) <0.001* Down regulation

Table 5: Fold changes of the miRs in aggressive PTC and comparison of them in blood and tissue. *Significant at P<0.05.

Group N Mean of fold change Std. Deviation Std. Error Mean One sample t test P value Independent t test P value
mir_16 blood 18 2.854247 3.1674688 0.7465796 0.024* 0.020*
tissue 18 0.920071 1.0990411 0.2590465 0.761
mir_34 blood 18 0.198956 0.1896811 0.0447083 0.000* 0.377
tissue 18 0.286675 0.3702283 0.0872637 0.000*
mir_146 blood 18 48.101287 30.1388044 7.1037843 0.000* 0.239
tissue 18 60.617704 32.4837004 7.6564816 0.000*
mir_877 blood 18 0.220025 0.1853129 0.0436787 0.000* 0.088
tissue 18 0.700225 1.144368 0.2697301 0.282
let_7 blood 18 0.093891 0.0760213 0.0179184 0.000* 0.265
tissue 18 0.136635 0.1406197 0.0331444 0.000*
molecular-biomarkers-diagnosis-blood-expression

Figure 1. Fold changes of the expression of the miRs. Black (left) columns are for blood expression and white (right) columns are for tissue expression. The error bars indicate 95% confidence interval. The reference line fold change =1 shows calibration line (aggressive PTC vs non-aggressive PTC). *Significant at P<0.05; independent t-test. #Significant at P<0.05; one sample t test (the baseline fold change=1 is the null hypothesis).

Discussion

The present study was designed in order to find the role of circulating and tumor tissue miRs in invasion of PTC. At this level we could find significant association of 3 miRs with invasion of PTC in both blood and tumor tissue, and association of 2 miRs with invasion of PTC in blood. MiR-16 showed significant up regulation in blood, miR-34 showed significant down regulation in blood and tumor tissue, miR-146 showed significant up regulation in blood and tumor tissue, miR-877 showed significant down regulation in blood, and let-7 showed significant down regulation in blood and tumor tissue. Expression change of miR-16 was significantly more dominant in blood in favor of up regulation. Since there was no significant difference between the fold changes of the miRs in blood and tissue (except miR-16), blood serum expression study of these miRs can be used in clinics as an available and representative source instead of tumor tissue

PTC is a cancer with good prognosis. The necessity of total thyroidectomy may be affected by its aggressive behavior. Since aggressive behavior of PTC was hard to predict, many studies were trying to have research on biomarkers. Linwah et al. studied 17 aggressive and 15 non-aggressive PTC patients in USA in order to find the role of tissue miR signature. They found up regulation for miR-146b, -221, -222, -155, -31, and down regulation for miR-1, -34b, -130b, -138 in aggressive PTC. Our study supported this finding for the common miRs [14]. Yang et al. studied 20 aggressive and 20 non-aggressive patients in China. They found up regulation of miR 146b 5p and miR 221/222 and down regulation of miR 16 and miR 613 in aggressive PTC. In contrast, our study did not show down regulation for miR 16 [4]. Lee et al. in Australia found that miR-222 and miR-146b had over expression in PTC via comparing tumor tissue and plasma of 9 recurrent and 17 non-recurrent PTC patients [15]. Rosignolo et al. in Italy found association of miR 146b-5p and miR 222 3p up regulation with increased risk of recurrence [16]. Chou et al. introduced miR-146b as novel biomarker in PTC. They believed that this miR was associated with aggressiveness and prognosis. Different mechanisms had been suggested for the initiating role of miR 146b in oncogenic pathways. One of them was that miR 146b inhibited TGF-β anti-signal via down regulation of SMAD4 and therefore inhibition of cell cycle arrest [17].

The most important limitation of this study and the previous studies was the study design. Although such studies named their groups as cohorts of PTC, but from the critical appraisal point of view in evidence-based medicine, they were not eligible cohort studies. Since the practical aim of this topic is prediction of aggressiveness, occurrence of PTC and its aggression should be subsequent to these biomarker changes.

Conclusion

In general, our study in an Iranian population supported the previous results. miRs can help to differentiate invasive PTC from non-invasive PTC. Briefly, miR-16 and miR-877 showed up regulation in blood, miR-34 and let-7 showed down regulation in blood and tumor tissue, miR-146 showed significant up regulation in blood and tumor tissue, and miR-146 showed significant up regulation in blood and tumor tissue. Expression change of miR-16 was significantly more dominant in blood in favor of up regulation. Predicting role of these biomarkers should be investigated in well-designed cohort studies. Then the results can be used as personalized medicine in management of PTC.

Acknowledgments

We take it upon ourselves to appreciate all hospitals help us for sample collection. We acknowledge Firoozgar Clinical Research Development Center (FCRDC) of Iran University of Medical Sciences.

Funding

Funding is being done by Islamic Azad University, North Tehran Branch, as a PhD thesis.

References

Google Scholar citation report
Citations: 2054

Journal of Molecular Biomarkers & Diagnosis received 2054 citations as per Google Scholar report

Journal of Molecular Biomarkers & Diagnosis peer review process verified at publons

Indexed In

 
arrow_upward arrow_upward