GET THE APP

Effect of TLR6-5 gene on different economic traits along with its polymorphism, sequencing and phylogenetic analysis in swine
Veterinary Science & Technology

Veterinary Science & Technology

ISSN: 2157-7579

Open Access

Effect of TLR6-5 gene on different economic traits along with its polymorphism, sequencing and phylogenetic analysis in swine


2nd Indo-Global Summit & Expo on Veterinary

October 26-28, 2015 Hyderabad, India

Nandani Kumari, L B Singh and Saroj Kumar Thakur

Birsa Agricultural University, India

Posters-Accepted Abstracts: J Vet Sci Technol

Abstract :

The current study was proposed to see the effect of TLR6 gene on different selective economic traits (Growth+Reproductive traits) along with polymorphism, sequence and phylogenetic study of TLR6 gene in Sus scrofa. For it nine primers were taken. DNA was extracted from 48 animals at R.V.C., Pig farm belonging to three genetic groups namely Tamworth, Desi and T&D were subjected to SSCP. The result after analysis with SPAB was sent for sequencing at Xcleris. Sequencing result was studied with DNASTAR and further used for phylogenetic studies using BLAST and NCBI. A total of six growth traits namely body weight at 0-day, 7-day, 14-day, 28-day, 42-day and 56-day and reproductive traits namely Litter size at birth and weaning and litter weight at birth and weaning. The 5th primer with forward and reverse base sequence as 5�¢���� GTCCTCAGGTACCAAGCACA 3�¢���� and 3�¢����TGGAAAGGCTGCTAAAGGAA5�¢���� respectively has four haplotypes namely A, B, C and D. In Desi, Tamworth and T&D, Haplotypes A, A&C and D had the highest value of 57.14%, 35.71 and 60.00 respectively. The population means were observed to be 09.378���±00.7323, 10.945���±00.8840 kg, 09.030���±00.5850 and 81.275���±6.7156, 01.178���±00.086, 01.689���±00.3480, 02.950���±00.5387, 04.057���±00.5821, 05.976���±00.5881 & 06.935���±00.9902 kg for litter size at birth, litter weight at birth, litter size at weaning, litter weight at weaning, body weight at birth, body weight at 7-day, body weight at 14-day, body weight at 42-day and body weight at 56-day respectively. Haplotypes for primer-5 (TLR6-5) had nonsignificant effect on all the traits. The nucleotide sequence alignments were carried out using alignment tools, viz., Clustal W (DNA star Inc. USA) and BLAST to reveal single base variations. With respect to TLR 6-5 gene fragment, phylogenetic studies showed the genetic distance among the different species of animals with reference sequence ICI/40627 of TLR6-5 gene fragment from which TLR6 mRNA and TLR 6, TLR 1 and TLR10 seems to have evolved. Further based on this sequence Sus scrofa is equidistant from other domestic animals with respect to phylogeny. These studies could be used for MAS based on disease resistance. The research coupled with further work on the same topic could be crucial for breeding, genetics as well as evolutionary studies.

Biography :

Email: drnandanikumari@gmail.com

Google Scholar citation report
Citations: 4472

Veterinary Science & Technology received 4472 citations as per Google Scholar report

Veterinary Science & Technology peer review process verified at publons

Indexed In

 
arrow_upward arrow_upward