GET THE APP

Journal of Phylogenetics & Evolutionary Biology

Journal of Phylogenetics & Evolutionary Biology

ISSN: 2329-9002

Open Access

Volume 1, Issue 4 (2013)

Research Article Pages: 1 - 7

The Distribution of Polyhedral Bacterial Microcompartments Suggests Frequent Horizontal Transfer and Operon Reassembly

Farah Abdul-Rahman, Elsa Petit and Jeffrey L Blanchard

DOI: 10.4172/2329-9002.1000118

Bacterial microcompartments (BMCs) are proteinaceous organelles that carry out specific metabolic reactions. Using domain representations of the BMC shell proteins, we identified BMCs in genomes of 358 bacterial species including human gut microbes, bioremediation agents, cellulosic ethanol producers, and pathogens. Multiple BMCs of different metabolic types are present in 40% of the BMC-containing genomes. BMC genes frequently clustered at a single locus that includes enzymes related to the compartment’s metabolic function. The distribution of BMC-containin species was mapped onto a phylogenetic tree constructed from 16S rRNA sequences. The presence of BMCs was sporadically distributed across the phylogenetic tree. All bacterial families that contained species with BMCs also had species without them. Even within a species, BMC number varied, indicative of frequent horizontal transfer and gene loss. Similarly, phylogenetic trees constructed from individual BMC genes indicated that horizontal gene transfer of the BMC loci is a common occurrence.

Research Article Pages: 1 - 9

Phylogenetic Analyses of the Genus Hymenobacter and Description of Siccationidurans gen. nov., and Parahymenobacter gen. nov

Gundlapally Sathyanarayana Reddy

DOI: 10.4172/2329-9002.1000122

Phylogenetic analyses of 26 species of the genus Hymenobacter based on the 16S rRNA gene sequences, resulted in polyphyletic clustering with three major groups, arbitrarily named as Clade1, Clade2 and Clade3. Delineation of Clade1 and Clade3 from Clade2 was supported by robust clustering and high bootstrap values of more than 90% and 100% in all the phylogenetic methods. 16S rRNA gene sequence similarity shared by Clade1 and Clade2 was 88 to 93%, Clade1 and Clade3 was 88 to 91% and Clade2 and Clade3 was 89 to 92%. Based on robust phylogenetic clustering, less than 93.0% sequence similarity, unique in silico restriction patterns, presence of distinct signature nucleotides and signature motifs in their 16S rRNA gene sequences, two more genera were carved to accommodate species of Clade1 and Clade3. The name Hymenobacter, sensu stricto, was retained to represent 17 species of Clade2. For members of Clade1 and Clade3, the names Siccationidurans gen. nov. and Parahymenobacter gen. nov. were proposed, respectively, and species belonging to Clade1 and Clade3 were transferred to their respective genera. The genera Hymenobacter (sensu stricto), Siccationidurans gen. nov. and Parahymenobacter gen. nov. contained the signature motifs AAGGCTTTCTGAGTCGTAAA (414-432), TGACGGTACCTGAGGAATAA (480-499) and ATTAATACCGCATAACACT (168-185) in their 16S rRNA gene sequences, respectively. Further, the genus Hymenobacter was emended and proposed a more acceptable genus description.

Research Article Pages: 1 - 9

Clarifying Mitochondrial DNA Subclades of T2e from Mideast to Mexico

Felice L Bedford, Doron Yacobi, Gary Felix and Federico M Garza

DOI: 10.4172/2329-9002.1000121

We report on two of the oldest mitochondrial DNA clusters in existence with Jewish affiliation. Both are in haplogroup T2e1. Four unrelated individuals from the Mexico mtDNA project were found to have the control region mutations that characterize a Sephardic signature previously reported (motif 16114T-16192T within T2e). Full genomic sequencing found the identical coding region mutations as Sephardic individuals which provides genetic evidence for founders of Northern Mexico that were both female and Sephardic Jewish. This is in contrast to a more common finding of European male, but local female founders and additionally lends biological support to anecdotes and historical reports of Crypto-Jewish founding of the Coahuila, Nuevo León, and Tamaulipas regions of Mexico and influx to Southern Texas, USA. The haplotype is nested in an old tree with mutations at positions 2308 and 15499, presently of uncertain geographic origin. The second cluster, a Bulgarian Sephardic founding lineage (9181G within T2e) previously reported, was found here in a population of largely Americans of European descent, but only among Jewish individuals. The non-synonymous mutation in ATPase 6 was found among both Ashkenazi and Sephardic Jews from diverse regions of Czech Republic, Lithuania, the Netherlands, Poland, and Romania. Full genomic sequencing found great coding region variability with several haplotypes and suggested a Near East origin at least 3000 years old. This predates the split between Jewish groups, but more recent admixture between Sephardim and Ashkenazim cannot be ruled out. Together the two Jewish-affiliated clusters account for all the genetic distance found in branch T2e1 and much of T2e. The findings suggest reexamination of the origins of mitochondrial DNA haplogroup T2e as Levantine or early back migration to the Near East. New subclades of T2e are identified.

Research Article Pages: 1 - 5

Sequence Diversity at Cyt-b and Co-1 mtDNA Genes in Animal Taxa Proved Neo-Darwinism

Yuri Ph Kartavtsev

DOI: 10.4172/2329-9002.1000120

Nucleotide sequences of mitochondrial DNA (mtDNA) depict the process of molecular evolution and speciation in animals. A dataset of about twenty three thousand sequences of 2 genes, Cyt-b and Co-1, among different species was analyzed at 5 taxa ranks across the Animal Kingdom. The results support the prevalence of a geographic or allopatric speciation and suggest that Darwin’s gradual evolution in animals also prevails at the molecular level. The approach suggested allows recognize the geographic and other speciation modes, using the set theory equations and genetic terms as their components. The suggested approach may solve a key problem of the Biological Species Concept, i.e. the inability of evolutionary studies to monitor the reproductive isolation among species in nature, by defining a species rank with measurable estimates of genetic parameters.

Research Article Pages: 1 - 9

Molecular Contiguity between Human and Animal Consciousness through Evolution: Some Considerations

Massimo Cocchi, Fabio Gabrielli, Lucio Tonello, Mauro Delogu, Valentina Beghelli, Michela Mattioli and Pier Attilio Accorsi

DOI: 10.4172/2329-9002.1000119

This work suggests the possibility of the existence of contiguity in the molecular evolution of consciousness, between man and animal. From the experimental point of view and in terms of hypotheses, it seems that many elements lead to considerations about a common molecular evolutionary origin of the consciousness in animals and humans. It seems, also, evident that the increasing levels of complexity of consciousness can correspond to the evolutionary process. The work discusses a scientific speculation about the possible role of serotonin and thermoregulation in the evolution of consciousness of living beings.

Research Article Pages: 1 - 8

Evolutionary Interrelationships and Insights into Molecular Mechanisms of Functional Divergence: An Analysis of Neuronal Calcium Sensor Proteins

Jeffrey Viviano, Hao Wu and Venkat Venkataraman

DOI: 10.4172/2329-9002.1000117

The normal function of any organism, its organizational complexity notwithstanding, depends on the interaction of its proteins with their targets. Thus, analysis of target site interaction is an essential part of all biology. At the protein level, such analyses are critical to both mechanistic knowledge and potential clinical applications such as drug discovery. Approaches to map amino acid residues involved in target site interaction typically are experimental or based on three-dimensional structures obtained through crystallography. Here we test a novel approach that combines phylogenetic analyses with mining of experimental data using neuronal calcium sensor proteins. The proteins fall into three groups based on sequence comparison. One interaction was taken up for analysis from each group. Using the sequence divergence to evaluate the role of amino acids identified experimentally to form the interface with the target, we demonstrate that it is possible to predict residues that are likely to contribute to the specificity of the interaction and, therefore, the functional divergence. Thus, evolutionary analyses of proteins provide an important addition in approaches to generate refined maps of target site interactions in proteins. This approach is especially useful in delineating the functional divergence in a family of closely related proteins.

arrow_upward arrow_upward